View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1228_high_29 (Length: 238)
Name: NF1228_high_29
Description: NF1228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1228_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 4393540 - 4393650
Alignment:
| Q |
1 |
cagaacaagaatcagaaccagaaccagaatcagaatcaagatcaaccaccacaacaaaaccctaattcactttctcaaatttctgctactgtaccctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4393540 |
cagaacaagaatcagaaccagaaccagaatcagaatcaagatcaaccaccacaacaaaaccctaattcactttctcaaatttctgctactgtaccctcat |
4393639 |
T |
 |
| Q |
101 |
cttcttcatct |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
4393640 |
cttcttcatct |
4393650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University