View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1228_low_26 (Length: 348)
Name: NF1228_low_26
Description: NF1228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1228_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 335
Target Start/End: Complemental strand, 35818964 - 35818630
Alignment:
| Q |
1 |
tagtagtggtagcttgtgttgcaagacagggcatgggttatatgatttgttggggatgtggttttattaggcatgcatacatatttacagaatacagtaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
35818964 |
tagtggtggtagcttgtgttgcaagatagggcatgggttatatgatttgttggtgatgtggttttattaggcatgcatacatatttacataatacaataa |
35818865 |
T |
|
| Q |
101 |
gttttaatttatggtgacagcagaagaaacaacacttttctaacaacggatgatttaatgtagtaacatggattctgttttcgcctgatacataagactt |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35818864 |
gttttaatctatggtgacagcagaagaaacaacacttttctaacaacggatgatttaatgtagtaacatggcttctgttttcgcctgatacataagactt |
35818765 |
T |
|
| Q |
201 |
tgtagtctaatttaaactctcacaagaacaccgttcaagctgcacaactgaaggctggataagctgcctgtggttgtatatttagaaaaggatcgatgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| || |||| |
|
|
| T |
35818764 |
tgtagtctaatttaaactctcacatgaacaccgttcaagctgcacaactgaaggctggataagctgcctgtggtcgtatatttagaaatggaacggtgtt |
35818665 |
T |
|
| Q |
301 |
tggttgtctggtttctctaaatatcttggcaacag |
335 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
35818664 |
tggttgtctggtttctctaaatatattggcaacag |
35818630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University