View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1228_low_32 (Length: 290)
Name: NF1228_low_32
Description: NF1228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1228_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 64 - 261
Target Start/End: Complemental strand, 32793286 - 32793087
Alignment:
| Q |
64 |
gtggatgtttaacactaaataagtgatataaatcatgactcatgcataatacatt--gattttgggtgaatatgtaatattcaatttcacttttatttaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32793286 |
gtggatgtttaacactaaataagtgatataaatcatgactcatgcataatgcattaggattttgggtgaatatgtaatattcaatttcacttttatttaa |
32793187 |
T |
|
| Q |
162 |
aaaaggtatggttaaatttactcatgtgattgttataagcttagtgtgatgattcccatgttctcctcaagacacaacacaagcttggagacatggcttg |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32793186 |
aaaaggtatggctaaatttactcatgtgattgttataagcttagtgtgatgattcccatgttctcctcaagacacaacacaagcttggagacatggcttg |
32793087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 7 - 41
Target Start/End: Complemental strand, 40290699 - 40290665
Alignment:
| Q |
7 |
gtctctggctgacacacatacactaataataattt |
41 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
40290699 |
gtctctggctgacacacagacactaataataattt |
40290665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University