View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1228_low_37 (Length: 271)
Name: NF1228_low_37
Description: NF1228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1228_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 165
Target Start/End: Original strand, 53834563 - 53834689
Alignment:
| Q |
37 |
attagtaccattatgtacactgaatgaagggaacttaatcatattctttaggtatagaaatctgagcttaattctagaatgtgtgtatggatatnnnnnn |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53834563 |
attagtaccattatgtacactgaatgaagggaacttaatcatattctttaggtatagaaatctgagcttaattctagaa--tgtgtatggatataaaaaa |
53834660 |
T |
|
| Q |
137 |
ncagaactgtaggaagagataatctaagg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53834661 |
acagaactgtaggaagagataatctaagg |
53834689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 213 - 269
Target Start/End: Original strand, 53834737 - 53834793
Alignment:
| Q |
213 |
tggacaagacatgcccataaccacattggggcagcgatgatctaaccttgttaaata |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53834737 |
tggacaagacatgcccataaccacattgggacagcgatgatctaaccttgttaaata |
53834793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University