View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12291_low_1 (Length: 408)
Name: NF12291_low_1
Description: NF12291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12291_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 196 - 389
Target Start/End: Complemental strand, 50440515 - 50440322
Alignment:
| Q |
196 |
gtaatggatgctttagtaaatgtagatgtcaggtatagaaagtatacaattgaggaaattgaagctgcaacaaannnnnnnncacaatccctcaagattg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50440515 |
gtaatggatgctttagtaaatgtagatgtcaggtatagaaagtatacaattgaggaaattgaagctgcaacaaattttttttcacaatccctcaagattg |
50440416 |
T |
|
| Q |
296 |
gagaaggaggatatggtccagtttttaagtgccttctggaccatacacctgttgcagtcaaggttctacgccccgatgcagcacaaggacgatc |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50440415 |
gagaaggaggatatggtccagtttttaagtgccttctggaccatacacctgttgcagtcaaggttctacgccccgatgcagcacaaggacgatc |
50440322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 3 - 123
Target Start/End: Complemental strand, 50440708 - 50440588
Alignment:
| Q |
3 |
agaagaagaaaggagattggaagaggcaaggatggccgaggaatctgcattggcaattgcagaaaaggagaaagaaaaatctaaagcagccattgaggcc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50440708 |
agaagaagaaaggagattggaagaggcaaggatggccgaggaatctgcattggcaattgcagaaaaggagaaagaaaaatctaaagcagccattgaggcc |
50440609 |
T |
|
| Q |
103 |
gctgaagcacaaaaaaggata |
123 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50440608 |
gctgaagcacaaaaaaggata |
50440588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 7e-19; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 3 - 115
Target Start/End: Original strand, 1273000 - 1273112
Alignment:
| Q |
3 |
agaagaagaaaggagattggaagaggcaaggatggccgaggaatctgcattggcaattgcagaaaaggagaaagaaaaatctaaagcagccattgaggcc |
102 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||| || |||||||||||||| | ||||||| ||| || | |||||| |||||||| ||||| || |
|
|
| T |
1273000 |
agaagaagagaggagattggaggaggcaagaatggctgaagaatctgcattggctgtagcagaaatggaaaaggcaaaatcaaaagcagcaattgaagct |
1273099 |
T |
|
| Q |
103 |
gctgaagcacaaa |
115 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1273100 |
gctgaagcacaaa |
1273112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 289 - 384
Target Start/End: Original strand, 1273286 - 1273381
Alignment:
| Q |
289 |
aagattggagaaggaggatatggtccagtttttaagtgccttctggaccatacacctgttgcagtcaaggttctacgccccgatgcagcacaagga |
384 |
Q |
| |
|
|||||||||||||| || |||||||| |||| ||| || ||||| |||||||| ||||| ||||| || ||||| || || |||||| ||||||| |
|
|
| T |
1273286 |
aagattggagaaggtggttatggtcccgtttataaatgtcttctagaccatactcctgtcgcagttaaagttctccgtcctgatgcacaacaagga |
1273381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 219 - 263
Target Start/End: Original strand, 1273216 - 1273260
Alignment:
| Q |
219 |
agatgtcaggtatagaaagtatacaattgaggaaattgaagctgc |
263 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
1273216 |
agatgtgaggtatagaaggtatgcaattgaggagattgaagctgc |
1273260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 319
Target Start/End: Original strand, 21001395 - 21001433
Alignment:
| Q |
281 |
aatccctcaagattggagaaggaggatatggtccagttt |
319 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
21001395 |
aatccttcaagattggagaaggaggatttggtccagttt |
21001433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 319
Target Start/End: Complemental strand, 21009972 - 21009934
Alignment:
| Q |
281 |
aatccctcaagattggagaaggaggatatggtccagttt |
319 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
21009972 |
aatccttcaagattggagaaggaggatttggtccagttt |
21009934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University