View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12293_high_6 (Length: 209)
Name: NF12293_high_6
Description: NF12293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12293_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 189
Target Start/End: Complemental strand, 38165550 - 38165373
Alignment:
| Q |
12 |
aggagtagcatttgaagagtgtctcttcagtgtagatctgaagaagggtctcatcaatttggactcaaagagtgaagtgaacaatccaaagctggctact |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38165550 |
aggaggagcatttgaagagtgtctcttcagtgtagatctgaagaagggtctcatcaatttggactcaaagagtgaagtgaacaatccaaagctggctact |
38165451 |
T |
 |
| Q |
112 |
acactatcttggaggcatgctgccaataatggcagcagccatgcttccactgatctggtcagtaccttcatacatcaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38165450 |
acactatcttggaggcatgctgccaataatggcagcagccatgcttccactgatctggtcagtaccttcatacatcaa |
38165373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University