View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12293_low_3 (Length: 345)
Name: NF12293_low_3
Description: NF12293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12293_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 200 - 327
Target Start/End: Complemental strand, 44380948 - 44380821
Alignment:
| Q |
200 |
gtgttgggtgaagattcattcctaagtctcttgcaatggttgcaagtttatatgtgtttgttatgatttcttgggttgggaggaataaaagaccaggtat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44380948 |
gtgttgggtgaagattcattcctaagtctcttgcaatggttgcaagtttatatgtgtttgttatgatttcttgggttgggaggaataaaagaccaggtct |
44380849 |
T |
|
| Q |
300 |
tttcttgaatgttgtttctttgggttgt |
327 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
44380848 |
tttcttgaatcttgtttctttgggttgt |
44380821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 44381159 - 44381067
Alignment:
| Q |
1 |
ttgaaggcacgtgggaagagggtaacaaagaaacgaagatgtgtcaatggcgttgtggcaaaagaaggaaaaggaatcggaatggcgtggttt |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
44381159 |
ttgaaggcgcgtgggaagagggtaacaaagaaacgaagatgtgtcaatggcgttgtggaaaaagaaggaaaaggaatgggaacggcgtggttt |
44381067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University