View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12294_high_3 (Length: 259)
Name: NF12294_high_3
Description: NF12294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12294_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 15 - 101
Target Start/End: Complemental strand, 4393157 - 4393071
Alignment:
| Q |
15 |
agagatgagagaagagttgatgtcatgctgccattggtgatgagtgttgcagggcttagacttaaacatgcttggccagtgtctatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4393157 |
agagatgagagaagagttgatgtcatgctgccattggtgatgagtgttgcagggcttagacttaaacatgcttggccagtgtctatt |
4393071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 4392993 - 4392933
Alignment:
| Q |
178 |
caaataaccaaatgagaaaacaatctagaagcttttctctcttgctttctgaaaccctcag |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4392993 |
caaataaccaaatgagaaaacaatctagaagcttttctctcttgctttctgaaaccctcag |
4392933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University