View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12294_low_2 (Length: 261)
Name: NF12294_low_2
Description: NF12294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12294_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 261
Target Start/End: Original strand, 42416127 - 42416377
Alignment:
| Q |
8 |
gaacctgtgccttccctttatcccgatcgtcgtgattgttattattattcagatgattcggtaagagagtgaaaccaggcggctcttcaggctcattttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42416127 |
gaacctgtgccttccctttatcccgatcgtcgtgattgttat---tattcagatgattcggtaagagagtgaaaccaggcggctcttcaggctcattttc |
42416223 |
T |
 |
| Q |
108 |
atacaaagtatcatcattctcagtagctgaagctttttcaccttgacactgaattgacattgcatcagatgttgataacagaacctcatctttccctttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42416224 |
atacaaagtatcatcattctcagtagctgaagctgtttcaccttgacactgaattgacattgcatcagatgttgataacagaacctcatctttccctttg |
42416323 |
T |
 |
| Q |
208 |
gggttcgccagtttatcgtagacagattgcaccgtttccacgatttcacctttc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42416324 |
gggttcgccagtttatcgtagacagattgcaccgtttccacgatttcacctttc |
42416377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University