View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12296_high_5 (Length: 323)
Name: NF12296_high_5
Description: NF12296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12296_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 32620734 - 32620846
Alignment:
| Q |
1 |
aactaacaatgctgat-ttaagctaaacaccgtcacatgtgttcaaactttagatctcacaattttgtacgtaagtttttgatgatgcttgttactttgt |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
32620734 |
aactaacaatgctgatattaagctaaacaccgtcacatgtgttcaaactttagatctcaccgttttgtacataagttttagatgatgctcgttactttgt |
32620833 |
T |
|
| Q |
100 |
ctcgtctcaagac |
112 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32620834 |
ctcgtctcaagac |
32620846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 188 - 315
Target Start/End: Original strand, 32620922 - 32621049
Alignment:
| Q |
188 |
tcccctattgtgtccagccattgtgattgtgcaggaaagacgacgtggcctatccannnnnnngttcttaagatatttctactttcattctt-gtccaaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32620922 |
tcccctattgtgtccagccattgtgattgtgcaggaaa---gacgtggcctatccatttttctgttcttaagatatttctactttcattcttggtccaaa |
32621018 |
T |
|
| Q |
287 |
cctctcc--aaaaccccttaattttcatctc |
315 |
Q |
| |
|
||||||| ||| |||||||||||||||||| |
|
|
| T |
32621019 |
cctctccgaaaatccccttaattttcatctc |
32621049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University