View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12297_high_5 (Length: 249)
Name: NF12297_high_5
Description: NF12297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12297_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 3939407 - 3939321
Alignment:
| Q |
18 |
agacaaacattagaatttaaagtgaagtttgacaattattgtaaatttagctagtgagaagtgacactcataccagttcaaaacgaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3939407 |
agacaaacattagaatttaaagtgaagtttgacaattattgtaactttagctagtgagaagtgacactcataccagaccaaaacgaa |
3939321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 165 - 230
Target Start/End: Complemental strand, 3939071 - 3939006
Alignment:
| Q |
165 |
gagagttttgagtaggggaaaatctaactgaggacagatatacattttcagtgacttcaacttgag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3939071 |
gagagttttgagtaggggaaaatctaactgaggacagatatacattttcagtgacttcaacttgag |
3939006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University