View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12297_low_3 (Length: 401)
Name: NF12297_low_3
Description: NF12297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12297_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 39 - 384
Target Start/End: Original strand, 13765748 - 13766093
Alignment:
| Q |
39 |
ggctaagggaagggatcttgttgtggtggaggtagctaataagaaccagtgtttggcgtatttgtggactattttgaagatctaagactcgtagatgttc |
138 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||| ||||||||||||||||||| ||||||| ||| |||||| |||| |||||||| |||||||| |
|
|
| T |
13765748 |
ggctaaggggagggatcttgtttttgtggaggtagctgataagaaccagtgtttggcctatttgtaaactgttttgacgatccaagactcgcagatgttc |
13765847 |
T |
|
| Q |
139 |
caatggtcaagagcaaaatggttgagagagagaaggacataatacaacttatttccacgcctgtgtgaagaatagaggtatgaggaattccatctcggca |
238 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13765848 |
caatggtcaagagcaaagtggttgagagagagaaggacataatacaacttatttcctcgcctgtgtgaagaatagaggtatgaggaattccatctcggct |
13765947 |
T |
|
| Q |
239 |
cctagggtggaaaggtggatggaggatgttgcaaagatcaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccga |
338 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13765948 |
cctagggtggaaaggtggatggatgatgttgcaaagaacaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccga |
13766047 |
T |
|
| Q |
339 |
ccatggtcgatattgatttcattcatatttctaatttggataatgt |
384 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13766048 |
ccatgggcgatattgatttctttcatatttctaatttggataatgt |
13766093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University