View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12298_high_4 (Length: 210)
Name: NF12298_high_4
Description: NF12298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12298_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 38831117 - 38831292
Alignment:
| Q |
20 |
agttcccacatcattgcttaactttcttcgactgccagattatacctttgtcagtgttggtattaaagatgatttggctaaacttaagaaggaatatggg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38831117 |
agttcccacatcattgcttaactttcttcgactgccagattatacctttgtcagtgttggtattaaagatgatttggctaagcttaagaaggaatatggg |
38831216 |
T |
 |
| Q |
120 |
attagatgcagaaatgctgtggaacttggacctcttgctgctagtgtcttgaaagtgcctcgtttggctttctgtg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831217 |
attagatgcagaaatgctgtggaacttggacctcttgctgctagtgtcttgaaagtgcctcgtttggctttctgtg |
38831292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 38820724 - 38820868
Alignment:
| Q |
22 |
ttcccacatcattgcttaactttcttcgactgccagattatacctttgtcagtgttggtattaaagatgatttggctaaacttaagaaggaatatgggat |
121 |
Q |
| |
|
||||||||||||||||||| |||||||| || ||||||||||||||||| |||||||||| || || |||||||||||||| |||||||||||||| | |
|
|
| T |
38820724 |
ttcccacatcattgcttaattttcttcgtcttccagattatacctttgttggtgttggtatcaatcataatttggctaaacttgagaaggaatatggggt |
38820823 |
T |
 |
| Q |
122 |
tagatgcagaaatgctgtggaacttggacctcttgctgctagtgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
38820824 |
tagatgcagaaatgctgtggaacttggacccttggctgctagtgt |
38820868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University