View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12298_low_6 (Length: 292)
Name: NF12298_low_6
Description: NF12298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12298_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 17887305 - 17887542
Alignment:
| Q |
17 |
tgatacctgttggaagaatagtagaaattcccaaccaatggagaatagagtaccaaacattgccataaaaattacaatgtaaaaacaaattattct---a |
113 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | | |
|
|
| T |
17887305 |
tgatacatgttggaagaacagtagaaattcccaacgaatggagaatagagtaccaaacattgccataaaaatgacaatgtaaaaacaaatgattatccga |
17887404 |
T |
 |
| Q |
114 |
ctcctccatcccacagccacaagagcataaaagagagtcagcttgaaaatttccacaactagccaagttatccttggttggtaatttgttattcgacaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
17887405 |
ctcctccatcccacagccacaagagcataaaagagagtcagcttgaaaatttccacaacaagccaagttatccttggttggtaatctgttattcaacaaa |
17887504 |
T |
 |
| Q |
214 |
caccaagctaggagagacactgttagaggcacacattt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17887505 |
caccaagctaggagagacactattagaggcacacattt |
17887542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 106
Target Start/End: Complemental strand, 10119364 - 10119323
Alignment:
| Q |
65 |
agtaccaaacattgccataaaaattacaatgtaaaaacaaat |
106 |
Q |
| |
|
||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
10119364 |
agtaccaaacattgcgataaaaattacagtctaaaaacaaat |
10119323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University