View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12299_low_17 (Length: 266)
Name: NF12299_low_17
Description: NF12299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12299_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 84 - 250
Target Start/End: Complemental strand, 23390172 - 23390006
Alignment:
| Q |
84 |
tcaacaatggttttggtgtacctatcatggaagaattaatgtgattgaaagtgaaaaatcttcccattctcttcagatgaaatcatgaagatagcttcaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23390172 |
tcaacaatggttttggtgtacctatcatggaagaattaatgtgattgaaagtgaaaaatcttcccattctctttagatgaaatcatgaagatagcttcaa |
23390073 |
T |
|
| Q |
184 |
acgaaattgcgatgaaagaagtggcagctattgtaattaagtgggtgtattcttaattggggatcaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23390072 |
acgaaattgcgatgaaagaagtggcagctattgtaattaagtgggtgtattcttaattggggatcaa |
23390006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 23390290 - 23390234
Alignment:
| Q |
21 |
agcgtcaaagtcatttgcaaggaagaaacac-ttggatgatattgatgcacaaattt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23390290 |
agcgtcaaagtcatttgcaaggaagaaacacattggatgatattgatgcacaaattt |
23390234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 25003876 - 25003927
Alignment:
| Q |
162 |
gaaatcatgaagatagcttcaaacgaaattgcgatgaaagaagtggcagcta |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25003876 |
gaaatcatgaagatagcttcaaactaaatttcgatgaaagaagtggcagcta |
25003927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University