View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12299_low_19 (Length: 261)

Name: NF12299_low_19
Description: NF12299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12299_low_19
NF12299_low_19
[»] chr5 (1 HSPs)
chr5 (15-243)||(8271901-8272129)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 8272129 - 8271901
Alignment:
15 ctgtgatcatcgatttcaaattgttggaggaattttggggttgcaataaagtttggttttttggaatcaaatggccgccgtggcggcttgccggcggttg 114  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8272129 ctgtgatcattgatttcaaattgttggaggaatttttgggttgcaataaagtttggttttttggaatcaaatggccgccgtggcggcttgccggcggttg 8272030  T
115 gggagattgaggaccaattccggggttggtttaactggattttctggctatggaatcggagcttccaaatttacgccttcaatttcgggttctatgtatt 214  Q
    |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
8272029 gggagattgaggactaattccggggttggtttaactggatttgctggctatggaatcggagcttccaaatttacgccttcaattttgggttctatgtatt 8271930  T
215 tttctggctttggtaaatcaaatggacaa 243  Q
    |||||||||||||||||||||||||||||    
8271929 tttctggctttggtaaatcaaatggacaa 8271901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University