View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12299_low_19 (Length: 261)
Name: NF12299_low_19
Description: NF12299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12299_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 8272129 - 8271901
Alignment:
| Q |
15 |
ctgtgatcatcgatttcaaattgttggaggaattttggggttgcaataaagtttggttttttggaatcaaatggccgccgtggcggcttgccggcggttg |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8272129 |
ctgtgatcattgatttcaaattgttggaggaatttttgggttgcaataaagtttggttttttggaatcaaatggccgccgtggcggcttgccggcggttg |
8272030 |
T |
 |
| Q |
115 |
gggagattgaggaccaattccggggttggtttaactggattttctggctatggaatcggagcttccaaatttacgccttcaatttcgggttctatgtatt |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8272029 |
gggagattgaggactaattccggggttggtttaactggatttgctggctatggaatcggagcttccaaatttacgccttcaattttgggttctatgtatt |
8271930 |
T |
 |
| Q |
215 |
tttctggctttggtaaatcaaatggacaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8271929 |
tttctggctttggtaaatcaaatggacaa |
8271901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University