View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12299_low_8 (Length: 340)
Name: NF12299_low_8
Description: NF12299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12299_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 334
Target Start/End: Original strand, 14492050 - 14492365
Alignment:
| Q |
19 |
ggacattacatgtctctttggggaaggatgctataaatcaatgataacctatccccaagttgttagttatttaagaccgtataaatcataaagtaatgtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14492050 |
ggacattacatgtctctttggggaaggatgctataaatcaatgataacctatcctgaagttgttagttatttaagaccgtataaatcataaggtaatgtc |
14492149 |
T |
|
| Q |
119 |
tgtatgaacttgcttgcatttcataatgaaagcaagcttctgaaggatctatcttttgatcataactagttgagagacctgtgctgaacatggatagtgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
14492150 |
tgtatgaacttgcttgcatttcataatgaaagcaagcttctgaaggatctatcttttgatcataactagttgagagacctgtgctgagcatgggtagtgc |
14492249 |
T |
|
| Q |
219 |
ggctgcgcctcacgtgacatgtgcgatgttgatttttggcaaataatatagtacaaattttatagtctttaagcaataattaattaatttcaatttaaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14492250 |
ggctgcgcctcacgtgacatgtgcgatgttgattgttggcaaataatatattacaaattttatagtctttaagcaataattaattaatttcaatttaaaa |
14492349 |
T |
|
| Q |
319 |
tttaataccacaggtt |
334 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14492350 |
tttaataccacaggtt |
14492365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University