View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12300_high_6 (Length: 237)
Name: NF12300_high_6
Description: NF12300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12300_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 51577641 - 51577858
Alignment:
| Q |
1 |
cggaagaagattattggaagaagttttaagaaagtggggtggggggtaaagtttgaaactttatctgtgcgtgtgaagtggggttttggttccttgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51577641 |
cggaagaagattattggaagaaattttaagaa-gtggggtggggggtaaagtttgaaactttatctgtgcgtgtgaagtggggttttggttacttgtttg |
51577739 |
T |
|
| Q |
101 |
ggtgtgagtgaaaaagtgttgtgaattgtgatgatgaagattgattgagagctttttgtgtgagaaattcttacttgaatttcaagatagctgcttgctt |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51577740 |
ggtg--agtgaaaaagtgttgtgaattgtgatgatgaagattgattgagagctttttgtgtgagaaattcttacttgaatttcaagatagctgcttgctt |
51577837 |
T |
|
| Q |
201 |
ggtgggggcagatcagagaga |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51577838 |
ggtgggggcagatcagagaga |
51577858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University