View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12300_low_11 (Length: 210)
Name: NF12300_low_11
Description: NF12300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12300_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 69 - 194
Target Start/End: Original strand, 51463365 - 51463491
Alignment:
| Q |
69 |
ctcccagaatgtacgattgcttgtcagcaatccacatatatgatcccc-acgtctgtgaaactaaaaatattgtttaagatcattcccaatggtgatgtc |
167 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
51463365 |
ctcccagaatgtacgattacttgtcagcaatcgacatatatgatcccccacgtctgtgaaactaaaaatattgtctaagatcatttccaatggtgatgtc |
51463464 |
T |
|
| Q |
168 |
ttcaccatttaagacataatatctgat |
194 |
Q |
| |
|
|||| |||||||||| | ||||||||| |
|
|
| T |
51463465 |
ttcatcatttaagacctgatatctgat |
51463491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University