View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12300_low_3 (Length: 431)
Name: NF12300_low_3
Description: NF12300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12300_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 183 - 348
Target Start/End: Complemental strand, 36001822 - 36001654
Alignment:
| Q |
183 |
gcttctttcaactcttcaattttctacaaccaagacttgtctccaccaaatattatgga---agcaaattcgagcttcttaatccgtgaatgtaaagaag |
279 |
Q |
| |
|
||||||||||| |||||||||||| || || |||||||||||||||||||||| |||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
36001822 |
gcttctttcaattcttcaattttccgcatcctagacttgtctccaccaaatattctggatgaagcaacttcgagcttctcaatccgtgaatgtaaagaag |
36001723 |
T |
 |
| Q |
280 |
ctagttctgatgagagtgtttgaaccgtcaacaatgcacttgatctgtcggaaaatgcattgttgatgg |
348 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||| ||| | ||| || |||||||||| |
|
|
| T |
36001722 |
ctagttctgatgaaagtgtttgaactgtcaacaatgcacttgatcggtcagcaaaagcgttgttgatgg |
36001654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 138 - 184
Target Start/End: Complemental strand, 36001888 - 36001842
Alignment:
| Q |
138 |
tatgctaccttgattcgttcatactctctatctgcacatattttagc |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36001888 |
tatgttaccttgattcgttcatactctctatctgcacaaattttagc |
36001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 348
Target Start/End: Complemental strand, 36012940 - 36012872
Alignment:
| Q |
280 |
ctagttctgatgagagtgtttgaaccgtcaacaatgcacttgatctgtcggaaaatgcattgttgatgg |
348 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
36012940 |
ctagttctgataagagtgtttgaaccatcaacaatgcacttcattgatcggaagttgcattgttgatgg |
36012872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 182 - 348
Target Start/End: Complemental strand, 36015763 - 36015599
Alignment:
| Q |
182 |
agcttctttcaactcttcaattttctacaaccaagacttgtctccaccaaat-attatgga---agcaaattcgagcttcttaatccgtgaatgtaaaga |
277 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| |||| ||||||| ||||| ||| |||| ||||| ||||||||||| ||| |||||| |||||| |
|
|
| T |
36015763 |
agcttctttcaacacttcaattttccgcaacctagacctgtctccgtcaaattattctggatgaagcaacttcgagcttctcaattagtgaatttaaaga |
36015664 |
T |
 |
| Q |
278 |
agctagttctgatgagagtgtttgaaccgtcaacaatgcacttgatctgtcggaaaatgcattgttgatgg |
348 |
Q |
| |
|
|| | ||||||| ||||||||| || |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
36015663 |
agtt-gttctgaa-----tgtttgaactatcgccaatgcacttgatcagtcggaaaatgcattattgatgg |
36015599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 36013099 - 36013037
Alignment:
| Q |
120 |
aaacaaaaaatatatctatatgctaccttgattcgttcatactctctatctgcacatattttagc |
184 |
Q |
| |
|
||||||||||| || |||| || ||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
36013099 |
aaacaaaaaatgtacctatttgttaccttgattcattcata--ctctatctgcacaaattttagc |
36013037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 184
Target Start/End: Complemental strand, 36015844 - 36015795
Alignment:
| Q |
135 |
ctatatgctaccttgattcgttcatactctctatctgcacatattttagc |
184 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||||||| |||| |||||||| |
|
|
| T |
36015844 |
ctatatgttaccttgattcgttgatattctctatcttcacaaattttagc |
36015795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University