View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12302_high_1 (Length: 411)
Name: NF12302_high_1
Description: NF12302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12302_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 266; Significance: 1e-148; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 17 - 332
Target Start/End: Original strand, 22506758 - 22507071
Alignment:
| Q |
17 |
aggttttcgtaggaagaaggtggtcttggagaaatttatctcttttaagttagtgtggaggtgtctatcagatgataatgtaattaggtcgaaactaatc |
116 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22506758 |
aggtttttgtaggaagaaggtggtcttcgagaaatttatctcttttaagttagtgtggaggtgtctatcagatgataatgtaattaggtcgaaactaatc |
22506857 |
T |
|
| Q |
117 |
aagttcagataaattacttaatttcgaacgtgaaaatgacagcaggatggactcaatttgatgacgtgatttatgctcagtcggaaaggaaaatggtgtt |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22506858 |
aagttcagataaattgcttaatttcgaacgtgaaaatgacagcaggatggactcaatttgatgacgtgatttatgctcagtcggaaaggaaaatggtgtt |
22506957 |
T |
|
| Q |
217 |
gaatcaaactggctaacaaccgcaagcagcaggaagataggaa--tgggaaaatacattattctggaatgaagtatatatagctaggtgagaacagtctt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
22506958 |
gaatcaaactggctaacaaccgcaagcagcaggaagataggaaacggggaaaatacattattctgtaatgaag----tatagctaggtcagaacagtctt |
22507053 |
T |
|
| Q |
315 |
tgcgatgagtttccggaa |
332 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22507054 |
tgcgatgagtttccggaa |
22507071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 355 - 399
Target Start/End: Original strand, 22507068 - 22507112
Alignment:
| Q |
355 |
ggaaaataacagtagcacatgaaagaaaccaggaagaaagcacag |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22507068 |
ggaaaataacagtagcacatgaaagaaaccaggaagaaagcacag |
22507112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 90 - 124
Target Start/End: Complemental strand, 10537491 - 10537457
Alignment:
| Q |
90 |
gataatgtaattaggtcgaaactaatcaagttcag |
124 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
10537491 |
gataatgtaatttggtcgaaactaatcaagttcag |
10537457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University