View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12302_low_3 (Length: 280)
Name: NF12302_low_3
Description: NF12302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12302_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 5 - 264
Target Start/End: Complemental strand, 12985091 - 12984832
Alignment:
| Q |
5 |
cagaacctgtgagttcagttggagagaatatgtcagtcaatgctgctgcccccaggaagcctcggattttactcgctactagtggaagtgttgctgcggt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12985091 |
cagaacctgtgagttcagttggagagaatatgtcagtcaatgctgctgcccccaggaagcctcggattttactcgctactagtggaagtgttgctgcggt |
12984992 |
T |
|
| Q |
105 |
taaatttgcaaatctttgtcattgtttctctgaatgggcagaagtaagagctgttgccacaaaatcgtctttgcattttattgaaagaacagcgattccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12984991 |
taaatttgcaaatctttgtcattgtttctctgaatgggcagaagtaagagctgttgccacaaaatcgtctttgcattttattgaaagaacagcgattccc |
12984892 |
T |
|
| Q |
205 |
aaagatgtgattttgtatacggacgacgatgaatggtctagttggaagaaactaggcgat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12984891 |
aaagatgtgattttgtatacggacgacgatgaatggtctagttggaagaaactaggcgat |
12984832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 57 - 124
Target Start/End: Complemental strand, 22796084 - 22796017
Alignment:
| Q |
57 |
caggaagcctcggattttactcgctactagtggaagtgttgctgcggttaaatttgcaaatctttgtc |
124 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22796084 |
caggaagcctcggattttacttgctactcgtggaagtgttgcagctgttaaatttgcaaatctttgtc |
22796017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University