View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12303_high_6 (Length: 340)

Name: NF12303_high_6
Description: NF12303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12303_high_6
NF12303_high_6
[»] chr1 (1 HSPs)
chr1 (23-312)||(32731839-32732128)


Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 23 - 312
Target Start/End: Original strand, 32731839 - 32732128
Alignment:
Q  23 catcatcaccaccggttatcctgaccctccggcgcatgggtcagcatagccgccgtgagtcctacccttctgcgtcatacgacttcctccaccaacgcca 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32731839 catcatcaccaccggttatcctgaccctccggcgcatgggtcagcatagccgccgtgagtcctacccttctgcgtcatacgacttcctccaccaacgcca 32731938  T
Q  123 tattgaaacggttattggtgaagaagatgggctggaatggccatttggaaatgtggaaagtatgagcgctgatgatgtgagggagacagcgtatgagatc 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32731939 tattgaaacggttattggtgaagaagatgggctggaatggccatttggaaatgtggaaagtatgagcgctgatgatgtgagggagacagcgtatgagatc 32732038  T
Q  223 tttttcacgtcatgccgatcaacgccggggttcggtggacgtcaaacgctgacgttttattctaaccatgagaataatggaggtggtgga 312  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||||||||    
T  32732039 tttttcacgtcatgccgatcaacgccggggtttggtggacgtcaaacgctgacgttttattctaaccatgacaatagtggaggtggtgga 32732128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University