View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12304_high_5 (Length: 429)
Name: NF12304_high_5
Description: NF12304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12304_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 1e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 233 - 414
Target Start/End: Complemental strand, 21867376 - 21867193
Alignment:
| Q |
233 |
ggcactatagagtaccttgattgaacacgactnnnnnnntattgttggcgcatacaaattaaattcgtactgataatggtttgtaaacnnnnnnnnnc-- |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
21867376 |
ggcactatagagtaccttgattgaacacgactaaaaaaatattgttggcgcatacaaattaaattcgtgctaataatggtttgtaaactttttttttttt |
21867277 |
T |
 |
| Q |
331 |
cgagtagattaatggcaataaattcatatttaaaagagaaaaagtggcattatcagttatgatttttggatcgcaaatgttttg |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21867276 |
cgagtagattaatggcaataaattcatatttaaaagagaaaaagtggcattatcaattatgatttttggatcgcaaatgttttg |
21867193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 16 - 171
Target Start/End: Complemental strand, 21868529 - 21868356
Alignment:
| Q |
16 |
tgtgttcctatgaatattgtgtcgaattaatgaaatagtttatccatttcttattttgaatcataaaattg-------------------ctacaatatt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||| |
|
|
| T |
21868529 |
tgtgttcctatgaatattgtgtcgaattaatgaaatagtttatccatctcttattttgaatcataaaattgctactaaagtaccatcacgctacgatatt |
21868430 |
T |
 |
| Q |
97 |
ttaataggatttaaacattgttggattgagattaattgttatccactggttataaaacttttttaatcttgcatc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
21868429 |
ttaataggatttaaacattgttggattgagattaattg-catccactggttataaaacttttttaatcgtgcatc |
21868356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University