View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12304_low_12 (Length: 241)
Name: NF12304_low_12
Description: NF12304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12304_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 40006690 - 40006912
Alignment:
| Q |
1 |
ttgacacaagttgtgacccctagcctccgtaagatatgacactattgacacatgttttctcccccaaaaacccactttggtccatgtgcagattatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006690 |
ttgacacaagttgtgacccctagcctccgtaagatatgacactattgacacatgttttctcccccaaaaacccactttggtccatgtgcagattatataa |
40006789 |
T |
 |
| Q |
101 |
cgaaaaaacaagatatcccataaagggagttggaaaatacatgtagaccatcgggcatattcatagcagaaagcatcatataagcgttttgaccgcaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006790 |
cgaaaaaacaagatatcccataaagggagttgcaaaatacctgtagaccatcgggcatattcatagcagaaagcatcatataagcgttttgaccgcaatt |
40006889 |
T |
 |
| Q |
201 |
aatatccaatctccaacgattct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40006890 |
aatatccaatctccaacgattct |
40006912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 50238092 - 50238003
Alignment:
| Q |
134 |
aaaatacatgtagaccatcgggcatattcatagcagaaagcatcatataagcgttttgaccgcaattaatatccaatctccaacgattct |
223 |
Q |
| |
|
||||||| |||| |||||| ||||| ||||||||||||||||||| ||| |||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
50238092 |
aaaatacctgtacaccatcaggcatgttcatagcagaaagcatcaaatacgcgttttgactgtaattaatatccaatctccaacgcttct |
50238003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University