View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12304_low_13 (Length: 219)
Name: NF12304_low_13
Description: NF12304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12304_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 7753217 - 7753401
Alignment:
| Q |
1 |
acatatttggaaccaaaaa-ggaattttttatcttaccattaaaggaaaccaatattttttcatcttaagatcagcaaactggatggtaacaccttttcc |
99 |
Q |
| |
|
||||||||||||||||||| |||| ||| | | ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
7753217 |
acatatttggaaccaaaaaaggaaattt--agcataccattaaaggaaaccaatattttttcatcttaagatctgcaaactggattgtaacaccttttcc |
7753314 |
T |
 |
| Q |
100 |
cattgattccaccgatttctacnnnnnnnnnnnnnnnnntgattataacttgcaccttgtgtatatgttgaatcttctgttttcattaactca |
192 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7753315 |
cattgattccacagatttctac------aaaaaaaaaaatgattataacttgcaccttgtgtatatattgaatcttctgttttcattaactca |
7753401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University