View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12304_low_14 (Length: 214)
Name: NF12304_low_14
Description: NF12304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12304_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 38 - 195
Target Start/End: Complemental strand, 40174873 - 40174712
Alignment:
| Q |
38 |
ttgttaactgaacagtt-cccaccctcaactctcacatgtattgaactatgattttt---atcatgaatcatatctatactctatacatagatatactta |
133 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40174873 |
ttgttaactgaacagtttcccaccctcaactctcacatgt-ttgaactgtgattttttttatcatgaatcatatctatactctatacatagatattctta |
40174775 |
T |
 |
| Q |
134 |
gatag-tgaagtccactttctctaattactagactatcctccatttgatttacccttttaacc |
195 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174774 |
gataggttaagtccactttctctaattactagactatcctccatttgatttacccttttaacc |
40174712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University