View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12304_low_9 (Length: 283)
Name: NF12304_low_9
Description: NF12304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12304_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 45054927 - 45055188
Alignment:
| Q |
18 |
aataccaagtgaaatctccatttcatggttcaagaaaggtccatcatatgcaattaaactgtcctcatctggcaaacatagaccagggataacagttgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45054927 |
aataccaagtgaaatctccatttcatggttcaagaaaggtccatcatatgcaattaaactgtcctcatctggcaaacatagaccagggataacagttgaa |
45055026 |
T |
 |
| Q |
118 |
cagtcttctatgctcacattggaagattttagttccgactcctggtgaatttggtcatcagggataattggagcaaaccgatcctgcttataacactccc |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45055027 |
cagtcttctattctcacattggaagattttagttccgactcctggtgaatttggtcatcagggataattggagcaaaccgatcctgcttataacactccc |
45055126 |
T |
 |
| Q |
218 |
aaagattgtccctctttgcaaatgttctaggagaaacaattccacatttcacaggttctgct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
45055127 |
aaagattgtccctctttgcaaatgttctaggagaaacaattccacattttccgggttctgct |
45055188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University