View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12305_high_13 (Length: 373)
Name: NF12305_high_13
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12305_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 120 - 368
Target Start/End: Original strand, 52380556 - 52380810
Alignment:
| Q |
120 |
ctgtgtaatcaacacctaaggagtaacctttgaacccgcatagttactaaacttctatggcgagtttgcttcgtaccaattccttactcacacgctctct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380556 |
ctgtgtaatcaacacctaaggagtaacctttgaacccgcatagttactaaacttctatggcgagtttgcttcgtaccaattccttactcacacgctctct |
52380655 |
T |
|
| Q |
220 |
attcgccgctcaggtacactttcgtcccctactgattttgttt------ttgcacagtgatcactatcatactaatttatctttctgtgtgtgcagggtg |
313 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380656 |
attcgccgctcaggtacgctttcttcccctactgattttgtttttgcagttgcacagtgatcacgatcatactaatttatctttctgtgtgtgcagggtg |
52380755 |
T |
|
| Q |
314 |
ttaaactaggactatcttccacttctcagattttgcgcttttcatccacaggttc |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
52380756 |
ttaaactaggactatcttccacttctcagattttgcacttttcatccaaaggttc |
52380810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 54
Target Start/End: Original strand, 52380453 - 52380490
Alignment:
| Q |
17 |
atataacacttcttcacttctgacatgcatcaacataa |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380453 |
atataacacttcttcacttctgacatgcatcaacataa |
52380490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University