View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12305_high_24 (Length: 286)
Name: NF12305_high_24
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12305_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 49654635 - 49654376
Alignment:
| Q |
1 |
ctggatacaacatgtacgattgctgacgtgtagggctgagattcacttgccccacaacctgacctggacactggaattctgctccagtgtctgcaggtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49654635 |
ctggatacaacatgtacgattgctgacgtgtagggctgagattcacttgccccacaacctgacctggacactggaattctgctccagtgtgtgcaggtgc |
49654536 |
T |
 |
| Q |
101 |
accagtagatgctgaactcaacccattgcttccagttccactctgagttttcttcatcttcttcttaccagaatctcctccgccactttgaccactcctg |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49654535 |
accggtagatgctgaactcaacccattgcttccagttccactctgagttttcttcatcttcttcttaccagaatctcctccgccactttgaccactcttg |
49654436 |
T |
 |
| Q |
201 |
ttctttgtttcctgccccttaccaccagccggagatttctccggtgagccagcacaggtt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49654435 |
ttctttgtttcctgccccttaccaccagccggagatttctccggtgagccagcactggtt |
49654376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 14381448 - 14381479
Alignment:
| Q |
18 |
gattgctgacgtgtagggctgagattcacttg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14381448 |
gattgctgacgtgtagggctgagattcacttg |
14381479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University