View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12305_high_29 (Length: 246)

Name: NF12305_high_29
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12305_high_29
NF12305_high_29
[»] chr5 (1 HSPs)
chr5 (18-230)||(19746334-19746546)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 19746546 - 19746334
Alignment:
18 aggtgcaagcacagatggatgggaggaagaagacgagactgatcctaaggtaccaggtctttcaatcggattattgtagagatcttcagttgaattatat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
19746546 aggtgcaagcacagatggatgggaggaagaagacgagactgatcctaaggtaccaggtctttaaatcggattattgtagagatcttcagttgaattatat 19746447  T
118 gatgaatactgttaaacattgctttaaagttggtgctcttctatgtccctatcttacatgtgtagattggtgatggaggaaatggtggtggggttgtctt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
19746446 gatgaatactgttaaacattgctttaaagttggtgctcttctatgtccctatcttacatgtgtagattggtgacggaggaaatggtggtggggttgtctt 19746347  T
218 gcaaaatgtgcca 230  Q
    |||||||||||||    
19746346 gcaaaatgtgcca 19746334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University