View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12305_low_18 (Length: 357)
Name: NF12305_low_18
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12305_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 13 - 348
Target Start/End: Complemental strand, 27296032 - 27295697
Alignment:
| Q |
13 |
cctgtgtctcaaacatcactgtcagggatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27296032 |
cctgtgtctcaaacatcactgtcagggatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttc |
27295933 |
T |
|
| Q |
113 |
atcaagcttatcagaaaatttaacttcaaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgattcaatcaaatgctgcaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295932 |
atcaagcttatcagaaaatttaacttcaaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgattcaatcaaatgctgcaaag |
27295833 |
T |
|
| Q |
213 |
ctctcattcaatccaaataccttcatcaaattgaatgaaaaatttgatctctaacaaattaaataaaaaattatgcagggtggatcaggttcagtacaag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295832 |
ctctcattcaatccaaataccttcatcaaattgaatgaaaaatttgatctctaacaaattaaataaaaaattatgcagggtggatcaggttcagtacaag |
27295733 |
T |
|
| Q |
313 |
gagtactattctcaaacatacaagtttcacaggttc |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295732 |
gagtactattctcaaacatacaagtttcacaggttc |
27295697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 14738636 - 14738722
Alignment:
| Q |
8 |
cagaacctgtgtctcaaacatcactgtcagggatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaa |
94 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||| || || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14738636 |
cagagcctgtgtctcaaacattactgtcagagatgtcaacatacacgactcaatgaatggtgttagaatcaaaacatggcaggtaaa |
14738722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 286 - 341
Target Start/End: Original strand, 14739019 - 14739074
Alignment:
| Q |
286 |
tgcagggtggatcaggttcagtacaaggagtactattctcaaacatacaagtttca |
341 |
Q |
| |
|
||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14739019 |
tgcagggtggatctggttcagtacagggagtattattctcaaacatacaagtttca |
14739074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University