View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12305_low_22 (Length: 332)
Name: NF12305_low_22
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12305_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 20139248 - 20139427
Alignment:
| Q |
1 |
agaacgacactacatgttaactacaacaggacacctattgttgacaagatctcaatattttgcccaagtatgatgttctcataccaggatatcccaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20139248 |
agaacgacactacatgttaactacaaccggacacctattgttgacaagatctcgatattttgcccaagtatgatgttctcataccaggatatccgaagaa |
20139347 |
T |
 |
| Q |
101 |
aaccacaaccctaaagatgttaagactttggtctaccattttgcaaggcgcatttatgcatagaggatgtagcaaatcct |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20139348 |
aaccacaaccctaaagatgttaagactttggtctaccattttgcaaggcgcatttatgcatagaggatgtagcaaatcct |
20139427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 217 - 262
Target Start/End: Original strand, 20139713 - 20139758
Alignment:
| Q |
217 |
tctataaagaatgaatcaatgattaagaaaactaaattgaaaccaa |
262 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20139713 |
tctataaagaatgaatctatgattaagaaaactaaattgaaaccaa |
20139758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University