View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12305_low_27 (Length: 286)

Name: NF12305_low_27
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12305_low_27
NF12305_low_27
[»] chr4 (1 HSPs)
chr4 (1-260)||(49654376-49654635)
[»] chr2 (1 HSPs)
chr2 (18-49)||(14381448-14381479)


Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 49654635 - 49654376
Alignment:
1 ctggatacaacatgtacgattgctgacgtgtagggctgagattcacttgccccacaacctgacctggacactggaattctgctccagtgtctgcaggtgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
49654635 ctggatacaacatgtacgattgctgacgtgtagggctgagattcacttgccccacaacctgacctggacactggaattctgctccagtgtgtgcaggtgc 49654536  T
101 accagtagatgctgaactcaacccattgcttccagttccactctgagttttcttcatcttcttcttaccagaatctcctccgccactttgaccactcctg 200  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
49654535 accggtagatgctgaactcaacccattgcttccagttccactctgagttttcttcatcttcttcttaccagaatctcctccgccactttgaccactcttg 49654436  T
201 ttctttgtttcctgccccttaccaccagccggagatttctccggtgagccagcacaggtt 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
49654435 ttctttgtttcctgccccttaccaccagccggagatttctccggtgagccagcactggtt 49654376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 14381448 - 14381479
Alignment:
18 gattgctgacgtgtagggctgagattcacttg 49  Q
    ||||||||||||||||||||||||||||||||    
14381448 gattgctgacgtgtagggctgagattcacttg 14381479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University