View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12305_low_32 (Length: 246)
Name: NF12305_low_32
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12305_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 19746546 - 19746334
Alignment:
| Q |
18 |
aggtgcaagcacagatggatgggaggaagaagacgagactgatcctaaggtaccaggtctttcaatcggattattgtagagatcttcagttgaattatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19746546 |
aggtgcaagcacagatggatgggaggaagaagacgagactgatcctaaggtaccaggtctttaaatcggattattgtagagatcttcagttgaattatat |
19746447 |
T |
 |
| Q |
118 |
gatgaatactgttaaacattgctttaaagttggtgctcttctatgtccctatcttacatgtgtagattggtgatggaggaaatggtggtggggttgtctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19746446 |
gatgaatactgttaaacattgctttaaagttggtgctcttctatgtccctatcttacatgtgtagattggtgacggaggaaatggtggtggggttgtctt |
19746347 |
T |
 |
| Q |
218 |
gcaaaatgtgcca |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19746346 |
gcaaaatgtgcca |
19746334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University