View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12305_low_39 (Length: 228)
Name: NF12305_low_39
Description: NF12305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12305_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 39 - 203
Target Start/End: Original strand, 10403070 - 10403243
Alignment:
| Q |
39 |
ttatgcggtacgagtggcatgtgctttcttgaacttttgtga---------acttttcatgcaagcttttgaaaatgaatatttgagcaagggtgaaaga |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10403070 |
ttatgcggtacgagtggcatgtggtttcttgaacttttgtgagggcattgtacttttcatgcaagcttttgaaaatgaatatttgagcaagggtgaaaga |
10403169 |
T |
|
| Q |
130 |
gttaaggcattaagaagtagacaacaaaaggaaataaaaatgaagtaaatatattaagaaacctaaatttgaat |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
10403170 |
gttaaggcattaagaagtaaacaacaaaagaaaataaaattgtagtaaatatattaagaaacctaaatttgaat |
10403243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University