View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12306_high_5 (Length: 270)
Name: NF12306_high_5
Description: NF12306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12306_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 12289343 - 12289140
Alignment:
| Q |
12 |
gtgctccaaaaccgattttcctttagttacttgctcggtaagaaggtgaaatcttgtttcaatgtgtttatttttccgatgtgctataagatgcttgatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12289343 |
gtgctccaaaaccgattttcctttagttacttgctctgtaagaaggtgaaatcttgtttcaatgtgtttgtttttccgatgtgctataagatgcttgatt |
12289244 |
T |
|
| Q |
112 |
aaattaatggaagatttgttgttaaccatcaatatcacaacttcttcttctttgattcttagttctagcattagggaatcaaaccaagcagcttgacacg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12289243 |
aaattaatggaagatttgttgttaaccatcaatatcacaacttcttcttctttgattcttagttctagcattagggaatcaaaccaagcagcttgacacg |
12289144 |
T |
|
| Q |
212 |
cact |
215 |
Q |
| |
|
|||| |
|
|
| T |
12289143 |
cact |
12289140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 80
Target Start/End: Complemental strand, 21547833 - 21547765
Alignment:
| Q |
12 |
gtgctccaaaaccgattttcctttagttacttgctcggtaagaaggtgaaatcttgtttcaatgtgttt |
80 |
Q |
| |
|
|||||||||||| | ||||||||||| |||| ||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
21547833 |
gtgctccaaaactaactttcctttagtgacttactctctaagaaagtgaaatcttgtttcaatatgttt |
21547765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University