View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12306_low_3 (Length: 393)
Name: NF12306_low_3
Description: NF12306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12306_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 10 - 390
Target Start/End: Complemental strand, 30054892 - 30054495
Alignment:
| Q |
10 |
accttggctgtaaggttcttccactttcgcgctggcgatgatggttgaatactttggtcattgaaagttttatacttgtggaggatgcagaaactctttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
30054892 |
accttggctgtaaggttcttccactttcgcgctggcgatgatggttgaatactttggtcattgaaagttttagacttgtggaggatgtagaaactctttg |
30054793 |
T |
 |
| Q |
110 |
tatatcaagtgacacacttgtcaatttgactat------gtatggat---------atgctagtttgatgtgcaacatatctgctcatttgctttccaac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30054792 |
tatatcaagtgacacacttgtcaatttgactatatatgggtatggatttgataccaatgctagtttgattggcaacatatctgctcatttgctttccaac |
30054693 |
T |
 |
| Q |
195 |
ttttcttttattggatctctcaaccaaaaaccatgccatatccatctttgttctgttaaacacgtttacaaggatgcagacatcggattc---aatcgcc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
30054692 |
ttttcttttattggatctctcaaccaaaaaccatgccatatccatctttgttctgttaaacatgtttacatggatgcagacatcggattcattaatcgcc |
30054593 |
T |
 |
| Q |
292 |
cgttggaagatgaatctgcagtcctactcaactggctactactagttttctaatatcaaatcattgactgtctcttctgatactccacaggttctgctc |
390 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
30054592 |
ccttggaagacgaatctgcagtcctactcaactggctactac-agttttctaatatcaaatcattgactgtctcttctgatactcttcaggttttgctc |
30054495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 92 - 146
Target Start/End: Complemental strand, 45906437 - 45906383
Alignment:
| Q |
92 |
ggatgcagaaactctttgtatatcaagtgacacacttgtcaatttgactatgtat |
146 |
Q |
| |
|
||||||| |||| ||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
45906437 |
ggatgcaaaaaccctttgcatatcaagtggaacacttgtcaatttaactatgtat |
45906383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University