View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12306_low_7 (Length: 217)
Name: NF12306_low_7
Description: NF12306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12306_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 1350703 - 1350593
Alignment:
| Q |
19 |
tatgtcgtcgacggcaaaaggctgggggcttgaagtgggtgaaggtcgttatgaaatgcagaggtgttgattgctaggtcgggaatgaagatgatagtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| ||||||| || | | | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350703 |
tatgtcgtcgacggcaaaaggctggg--cttgacgtggatgaaggttgtgaggga---cagaggtgttgattgctaggtcgggaatgaagatgatagtga |
1350609 |
T |
 |
| Q |
119 |
aggtcgttatgaaatgc |
135 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
1350608 |
aggt-gttatgaaatgc |
1350593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 199
Target Start/End: Complemental strand, 1350594 - 1350550
Alignment:
| Q |
155 |
gctaaggaatttatatttgactattacttttctcaccctattcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1350594 |
gctaaggaatttatatttgactattacttttctcatcctattcat |
1350550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University