View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12306_low_7 (Length: 217)

Name: NF12306_low_7
Description: NF12306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12306_low_7
NF12306_low_7
[»] chr5 (2 HSPs)
chr5 (19-135)||(1350593-1350703)
chr5 (155-199)||(1350550-1350594)


Alignment Details
Target: chr5 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 1350703 - 1350593
Alignment:
19 tatgtcgtcgacggcaaaaggctgggggcttgaagtgggtgaaggtcgttatgaaatgcagaggtgttgattgctaggtcgggaatgaagatgatagtga 118  Q
    ||||||||||||||||||||||||||  ||||| |||| ||||||| || | | |   ||||||||||||||||||||||||||||||||||||||||||    
1350703 tatgtcgtcgacggcaaaaggctggg--cttgacgtggatgaaggttgtgaggga---cagaggtgttgattgctaggtcgggaatgaagatgatagtga 1350609  T
119 aggtcgttatgaaatgc 135  Q
    |||| ||||||||||||    
1350608 aggt-gttatgaaatgc 1350593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 199
Target Start/End: Complemental strand, 1350594 - 1350550
Alignment:
155 gctaaggaatttatatttgactattacttttctcaccctattcat 199  Q
    ||||||||||||||||||||||||||||||||||| |||||||||    
1350594 gctaaggaatttatatttgactattacttttctcatcctattcat 1350550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University