View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12307_low_9 (Length: 249)
Name: NF12307_low_9
Description: NF12307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12307_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 22 - 233
Target Start/End: Original strand, 8764998 - 8765209
Alignment:
| Q |
22 |
agggagggaataaaatatcttgggctagctggtcaaaaatttgtaagctgaaaagagagggtgctttggaggtaatagatagatcttgttaacttggcca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8764998 |
agggagggaataaaatatcttgggctagctggtcaaaaatttgtaagctgaaaagagagggtgctttggaggtaagagatagatcttgttaacttggcca |
8765097 |
T |
 |
| Q |
122 |
tgtttggtaactagaggtggaggattctagcggagggtgatggcttgtggcgtagtatcttttcagccaggtatgggtctgccacgacgtcttgtaattt |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
8765098 |
tgtttggtaactggaggtggaggattctagcggagggtgatggcttgtggcgtagtatcttttcatccaggtatgggtctgccgcgatgtcttgtaattt |
8765197 |
T |
 |
| Q |
222 |
tgggatgagagc |
233 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8765198 |
tgggatgagagc |
8765209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University