View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12308_low_4 (Length: 336)
Name: NF12308_low_4
Description: NF12308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12308_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 14 - 320
Target Start/End: Complemental strand, 2019083 - 2018777
Alignment:
| Q |
14 |
ctgtgcattacaaagcaaaggtaacatgctatataattctgaaatttttgctctgaccaactttggtaaggcttcaaccccctcttctggtggctgagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2019083 |
ctgtgcattacaaagcaaaggtaacatgctatgtaattctgaaatttttgctctgaccaactttggtaaggcttcaaccccctcttctggtggctgagga |
2018984 |
T |
|
| Q |
114 |
atgcgactattaactattgatagtgaagtcacttctacatcttcaacattgggacatccgcnnnnnnngtccaacatgttagcacggtttccaaagacga |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
2018983 |
atgcgactattaactattgatagtgatgtcacttctacatcttcaacattgggacatccgcaaaaaaagtcaaacatgttagcacgatttccaaagacga |
2018884 |
T |
|
| Q |
214 |
cgtcgttcaaatttagggatttgagtaatggaaaattgatataggaagagccatctttgaaagtaacattttctagcttaagtgtgacaagattattgca |
313 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2018883 |
cgtcgttcaaattaagggatttgagtaatggaaaattgatataggaagagccatctttgaaagtaacattgtctagcttaagtgtgacaagattattgca |
2018784 |
T |
|
| Q |
314 |
agtgtag |
320 |
Q |
| |
|
||||||| |
|
|
| T |
2018783 |
agtgtag |
2018777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University