View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12308_low_6 (Length: 221)
Name: NF12308_low_6
Description: NF12308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12308_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 41846447 - 41846640
Alignment:
| Q |
17 |
aaagcatacacgtctgcctcttgtgaaagcttcttagcttccgcctgttctggagccctgtacccacccagccttgcaactgcgtgagcagggtttaata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41846447 |
aaagcatacacgtctgcctcttgtgaaagcttcttagcttccgcctgttctggagccctgtacccacccagccttgcaactgcgtgagcagggtttaata |
41846546 |
T |
|
| Q |
117 |
atagtgacaaaccaaagtcacctatgcaagcaaccccattcttgtcaagtatcacatttgatgatttcacatttccatgaggtatctgtgctgc |
210 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41846547 |
acagtgacaaaccaaagtcacctatgcaagcaaccccattcttgtcaagtatcacatttgatgatttcacatttccatgaggtatctttgctgc |
41846640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 61 - 195
Target Start/End: Complemental strand, 26890507 - 26890373
Alignment:
| Q |
61 |
ctgttctggagccctgtacccacccagccttgcaactgcgtgagcagggtttaataatagtgacaaaccaaagtcacctatgcaagcaaccccattcttg |
160 |
Q |
| |
|
|||||| || || ||||||||||||| | |||| ||| ||| |||||||||| | ||||||||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
26890507 |
ctgttcaggtgctctgtacccacccaatcgtgcagttgcatgaacagggtttaacagtagtgacaacccaaagtcagatatgcaagcaacaccgttcttg |
26890408 |
T |
|
| Q |
161 |
tcaagtatcacatttgatgatttcacatttccatg |
195 |
Q |
| |
|
||||||| ||||| ||||||||||| || ||||| |
|
|
| T |
26890407 |
tcaagtagtacattggatgatttcacgttcccatg |
26890373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University