View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12309_low_4 (Length: 269)
Name: NF12309_low_4
Description: NF12309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12309_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 56457603 - 56457365
Alignment:
| Q |
15 |
cagagacgcatctttaacctcaaattctatcttccttcatatcaataataaatcccaacaagtttctgcttcttcacttcttcattctcttcaggataga |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457603 |
cagagacacatctttaacctcaaattctatcttccttcatatcaataataaatcccaacaagtttctgcttcttcacttcttcattctcttcaggataga |
56457504 |
T |
 |
| Q |
115 |
ctcagcaaagtttcatccggcactaagaaacctgaccctatctatctcaaacttcgtacttctacttcacctcccttcaacttgattgatttgcctggac |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
56457503 |
ctcagcaaagtttcttccggcactaagagacctgaccctatctatctcaaacttcgtacttctactgcacctcccttcaacttgattgatttgcctggac |
56457404 |
T |
 |
| Q |
215 |
tggaccagcgtattgtcaatgacaaaatcatctctgaat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457403 |
tggaccagcgtattgtcaatgacaaaatcatctctgaat |
56457365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University