View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12309_low_6 (Length: 242)
Name: NF12309_low_6
Description: NF12309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12309_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 31901173 - 31901274
Alignment:
| Q |
1 |
ttttttaacaaccaaaagttattgagataacacaaaactggctgtcaaaacaaaacagcagcaccacatcataatatttgtgttcaagacaacaaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31901173 |
ttttttaacaaccaaaagttattgagataacacagatctggctgtcaaaacataacagcagcaccacatcataatagttgtgttcaagacaacaaaataa |
31901272 |
T |
 |
| Q |
101 |
ca |
102 |
Q |
| |
|
|| |
|
|
| T |
31901273 |
ca |
31901274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 140 - 223
Target Start/End: Original strand, 31925488 - 31925569
Alignment:
| Q |
140 |
ataataacttcaaatgataaccacttaagtaaatggttgtgcactccaattatgaaccaaattagaatccaaaaacatagtctc |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||| |||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31925488 |
ataacaacttcaaatgataaccacttaagtaa-tggctgtgca-tccatttatgaaccaaattagaatccaaaaacatagtctc |
31925569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University