View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12311_high_8 (Length: 267)
Name: NF12311_high_8
Description: NF12311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12311_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 229
Target Start/End: Complemental strand, 33940268 - 33940048
Alignment:
| Q |
10 |
agaacctgtggtatgaaatccaactacatggctatatgtatagttatccttggatataggaattgttgactacgtgtgatggcact-agcattgttgcag |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33940268 |
agaatctgtggtatgaaatccaactacatggctatatgtatagttatccttggatataggaattgttgactacgtgtgatggcacttagcattgttgcag |
33940169 |
T |
 |
| Q |
109 |
atcatgagatagtgatgctcaaataatgattcaaaattagatattgatcgatccattcttacctgattttcaggttcactagctagctagctagttggac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33940168 |
atcatgagatagtgatgctcaaataatgattcaaaattagatattgatcgatccattcttacctgattttcaggttcactagctagctagctagttggac |
33940069 |
T |
 |
| Q |
209 |
tcggttttgacaaattgatta |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33940068 |
tcggttttgacaaattgatta |
33940048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University