View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12312_high_13 (Length: 205)
Name: NF12312_high_13
Description: NF12312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12312_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 72 - 197
Target Start/End: Original strand, 19682334 - 19682459
Alignment:
| Q |
72 |
acccctcactggttggattcgacatttcctctccagcggtcaagcttcaacaggcgttcccaacatattgctgtcgttattggcattcttcaaggtccaa |
171 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
19682334 |
acccctcacaggttggattcgacatttcctctccagtggtcaagcttcaacaggcgttcccaacctattgttgttgttattggcattcttcaaggtccaa |
19682433 |
T |
 |
| Q |
172 |
taagggtcgagtgtctgtgctgctcc |
197 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
19682434 |
taagggtcgagtgtttgtgctgctcc |
19682459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University