View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12312_high_4 (Length: 369)
Name: NF12312_high_4
Description: NF12312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12312_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 6e-96; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 17128013 - 17128214
Alignment:
| Q |
18 |
agtgggctcaaagcaatgatttttagggatacggtttgtgtgtaggacgacactgcagtttgactgaacttacccgaatcctatttttactgggttttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17128013 |
agtgggctcaaagcaatgatttttagcgatccggtttgtgtgcaggatgacactgcagtttgactgaacttacccgaatcctatttttactgagttttta |
17128112 |
T |
|
| Q |
118 |
tgaactgtgtagtgtttgaagaatgttgattttatttgtagaagcatgttgtgatctagctgaatttgtgttgataatggaatttttgaatatgtgcagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17128113 |
tgaactgtgtagtgtttgaagaatgttgattttatttgtagaagcatgttgtgatctagctggatttgtgttgataatggaatttttgaatatgtgcagg |
17128212 |
T |
|
| Q |
218 |
tc |
219 |
Q |
| |
|
|| |
|
|
| T |
17128213 |
tc |
17128214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 305 - 352
Target Start/End: Original strand, 17128300 - 17128347
Alignment:
| Q |
305 |
ttttaagcctcgtggtggtggtagaggttttggaggtggcagaggagc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17128300 |
ttttaagcctcgtggtggtggtagaggttttggaggtggcagaggagc |
17128347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 150
Target Start/End: Original strand, 17127908 - 17127946
Alignment:
| Q |
112 |
tttttatgaactgtgtagtgtttgaagaatgttgatttt |
150 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
17127908 |
tttttatgaactgtgtagtgtttgaaaaatgttgctttt |
17127946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University