View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12312_low_4 (Length: 384)
Name: NF12312_low_4
Description: NF12312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12312_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 11 - 366
Target Start/End: Complemental strand, 13087994 - 13087639
Alignment:
| Q |
11 |
ggagcagagagacgacaacgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactcatcaacatagaagatggtttgggaacaag |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13087994 |
ggagcagtgagacgacaacgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactgatcaacatagaagatggtttgggaacaag |
13087895 |
T |
|
| Q |
111 |
gtttgtggggaccagtggaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087894 |
gtttgtggggaccagtggaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtga |
13087795 |
T |
|
| Q |
211 |
tttgatgcatggtccacgtccggtgaaggcatccacatttccgcgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087794 |
gttgatgcatggtccacgtccggtgaaggcatccacatttccacgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatc |
13087695 |
T |
|
| Q |
311 |
catactgattggttctttgcatcgtcgaatctaatgctgatttttgaatctgttcc |
366 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13087694 |
cacactgattggttctttgcatcgtcgaatctaatgctgattttcgaatctgttcc |
13087639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University