View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12312_low_9 (Length: 266)
Name: NF12312_low_9
Description: NF12312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12312_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 48 - 247
Target Start/End: Complemental strand, 17880721 - 17880520
Alignment:
| Q |
48 |
gttttagttataagaattaggggagagaaagaatgagttattcatttaggtattttgcttgttgtggtagaggcagtttgtgcactctgaaggatcacat |
147 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17880721 |
gttttagttataagaattagcggagagaacgaaagagttattcatttaggtattttgcttgttgtggtagaggcagtttgtgcactctgaaggatcacat |
17880622 |
T |
|
| Q |
148 |
ctcttggcagggaatccgtcaatt--atgagtttctgtttcctttccattcattagtatacacctttctgcaatttctattctactttattatcgctatt |
245 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17880621 |
ctcttggcagggaatccgtcaatttcatgagtttctgtttcctttccattcattagtatacacctttctgcaatttctattctactttattatcgctatt |
17880522 |
T |
|
| Q |
246 |
tc |
247 |
Q |
| |
|
|| |
|
|
| T |
17880521 |
tc |
17880520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 48 - 171
Target Start/End: Complemental strand, 15047803 - 15047681
Alignment:
| Q |
48 |
gttttagttataagaattaggggagagaaagaatgagttattcatttaggtattttgcttgttgtggtagaggcagtttgtgcactctgaaggatcacat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| || | || |||||||||| |||||| | ||||||||||||||||| | |||||||||||||| || | |
|
|
| T |
15047803 |
gttttagttataagaattaggggagagaatgagttggtcattcatttagttatttttcctgttgtggtagaggcagcgtatgcactctgaaggagcatag |
15047704 |
T |
|
| Q |
148 |
ctcttggcagggaatccgtcaatt |
171 |
Q |
| |
|
| ||| ||||||||||| |||||| |
|
|
| T |
15047703 |
ccctt-gcagggaatccatcaatt |
15047681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University