View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12313_high_11 (Length: 339)
Name: NF12313_high_11
Description: NF12313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12313_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 5548843 - 5549020
Alignment:
| Q |
14 |
gcagagacaacgtacgacaattcaaatagccaatgagagtgttctcaaattttggcttgttccatgtaatgggaaacgtaacactattgttgttactgct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5548843 |
gcagagacaacgtacgacaattcaaatagccaatgagagtgttctcaaattttggcttgttccatgtaatgggaaacgtaacactattgttgtcactgct |
5548942 |
T |
 |
| Q |
114 |
gttatagcagaagttgaaatggacggttgtgatgttgtcacattttttagatggaaaagacttatgaaaaatataata |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5548943 |
gttatagcagaagttgaaatggacggttgtgatgttgtcacattttttagatggaaaagacttatgaaaaatataata |
5549020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 320
Target Start/End: Original strand, 5549085 - 5549149
Alignment:
| Q |
256 |
tgtaacattgaatatttgagtcttatgtgtggttcatcgaggtggatatttcaatgagaccttag |
320 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5549085 |
tgtaacattgaatatttgagtcttatgtggggttcatcgaggtggttatttcaatgagaccttag |
5549149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University